Evolution

[Hagakure]

Evolution - how it happens

To understand evolution you first need a basic idea of biology. Every living creature on this planet is essentially cell based.

Cells are essentially self replicating machines. To keep it simple they have a code that tells the cell how to build certain machines that allow the cell to survive and self replicate (this is keeping it very very very simple).

the code, as most of you would know, is deoxyribonucleic acid (DNA). DNA is a sequence of 4 different types of bases. you may know binary where the information is provided with a series of 1's or 0's (your computer right now is working on this concept). DNA works on a similar premise.

There are four possible bases in DNA - Adenine (A), Guanine (G), Thymine (T) and cytosine ©.

these bases hold the information. they code in a linear manner and a possible sequence of bases would be

5' ATCGTAGCTTTAGCCAGTAGGCTTAGCTTGCTAGCTACTAGCT 3'

the double helix structure of DNA is due to 2 strands of DNA spiralling around each other - one strand is complementry to the other with a corresponding sequencing adherring to the rule that guanine will bind to cytosine and adenine will bind to thymine. so the corresponding sequence for the strand above would be

5' ATCGTAGCTTTAGCCAGTAGGCTTAGCTTGCTAGCTACTAGCT 3'

3' TAGCATCGAAATCGGTCATCCGAATCGAACGATCGATGATCGA 5'

As mentioned before DNA is where all of the information is stored - its the main hub of data. If the cell was a construction company DNA is all of the blueprints.

DNA provides the code required to make RNA (ribonucleic acid). RNA is like single stranded DNA. it has a uracil base that takes the place of thymine and a slightly different backbone but it again is a linear sequence of code with correspinding bases.

For RNA to be made it must be transcribed from the DNA. DNA is unzipped and the corresponding bases for RNA are sequenced into a chain through an RNA polymerase protein.

the RNA (messenger RNA or mRNA in this specific case) can now be used to make a protein. Ribosomes are the proteins responsible for making proteins. They read the code that is supplied by the RNA to make another chain again - this time an amino acid chain.

while RNA was a single strand copied base for base from DNA polypeptides are encoded in a different manner.

RNA is read by looking at the code in groups of 3s. the triplet UCU (the U is for uracil - as mentioned before think of it as RNAs version of thymine) ensures that the next amino acid required in the chain is serine. ACU on the other hand ensures that Threonine is the next amino acid in the chain. 4 possible bases and three in the the sequence means there are 64 possibilities. There is however some ovelap with some triplets bringing in the same amino acid. there are 23 possible amino acids plus three triplets of bases encode for the building of the amino acid chain to stop.

For those who are wondering what these amino acids are think of them as building blocks that are the main components for the machinery created by the cell. Some love water and are attracted to it, some hate it and try to get away from it, other amino acids will bind to each other. They have different chemical properties and after being made this long chain coils up to form a three dimensional structure. THe amino acids that dont like water will go to the inside while the ones that love it will go around the outside.

these are proteins and they do most of the stuff in your cells - they build compunds, break em down, act as signals whatever.

grab a drink - sit down and ponder this for a while and lets move on to evolution.

evolution is the concept that as a result of changes to the DNA code (mutations) the plans for the body change. Some mutations mean more RNA for the mutated gene will be made, others might mean that the sequence change influences a change in the RNA made and therefore a differently shaped protein will be made - this in turn will mean the protein may have a reduced or changed function.

mutations can have all different types of effects - i am scratching the surface.

so mutations are the reason for changes in the genes. i am going to go with one of the most classic examples of all time - giraffes.

giraffes and zebras probably had a common ancestor somewhere along the evolutionary tree.

evolution does not work in a method of BANG a mutation happens and now out of some horse like animal pops a freaky baby with a super long neck.

there are two crucial parts - the mutation and the selection. Somewhere along the line there must have been a mutation that caused one of these horse like animals to have a slightly longer neck (or in the early stages simply be slightly taller). this longer neck allows this animal to reach leaves on trees that others of its fellow kind cannot.

it has a far greater chance of of getting some action and making some babies as a lot of the competition in the dry season may starve. it will mate with other taller chums. This is the selective pressure. the tall survive - and as tallness reaches its limits the extension of the neck is the most energy efficient method of out competing others for those juicy leaves

at this point in time its interesting to note that the trees would also be feeling this pressure - short trees would have all of their leaves eaten and therefore die. only trees which have genes to grow very tall will survive and as they grow taller only the tallest giraffes will survive, its a bit of a race.

this takes ages and ages to happen. a creationist may look at the early stages of the giraffe when it is a horse like animal that is now slightly taller and call it micro evolution. "this is only the same horse like animal that is slightly taller and has a slightly longer neck" they might say. i kick em into my time machine and show that it takes a very very long time to happen.

so thats all the basics on evolution you probably all know. as i am still trying to delay doing actual study i will provide you with some more interesting information.

one of the most vital parts to effective evolution in us eukaryotes (organisms with nuclei - look it up im done with explaining the basics ) is having two sets of genes.

we get two sets of genes - one from our father one from our mother. there may be a mutation in a gene from our mother that is vital to our devlopment and we will die when it is in that mutated form - luckily we have our fathers set of genes aswell which compensate for this.

this double copy of genes means mutations can happen over time and when a functional protein is again reached it may provide some selective advantage - the odds of a mutation that hey presto makes a new super protein is pretty slim.

thats is why your mitochondrial genes which were orginally all contained in the mitochondria are slowly making their way into the nucleus. its a highly advantageous feature that has been vital in our evolution.

another cool fact is that those crazy little sequences of RNA are a lot more versitile than just carrying information.

These clever little suckers may have been responsible for the origin of life. RNA can act like proteins - not as efficient but back in the day it was a start.

the origin of life probably started with systems only involving RNA, then systems with RNA and proteins, then systems with DNA rna and proteins.

well that was a long post hit me up with any questions and i especially want to see any anti evolution arguments.

evolution is unscientific my ass

[devance]

There are morphing patterns to evolution.

For instance one star war the arena creature was based on a phasmid. Which is a leaf eater about 2 inches long.

But not to a tool user. evolution no longer happens

[Prophet]

I think i might be evolving into a half plant half man mutant where i can photosynthesise to obtain energy and thus i have to eat less. Sounds good in theory don't you think?

[apothecary]

Nevermind.

[ 28. May 2005, 06:57: Message edited by: apothecary ]

[Hagakure]

well prophet an individual cant evolve.

you will never be anything more than you are - you have your genes and apart for some mutations that cause cancer they are pretty much going to be the same.

it would indeed be great if we could photosynthesise but we have probably left the point from where we can do this.

chloroplasts are similar to mitochondria - they are both beleived to be small prokaryotic cells that have formed a symbiosis with the host eukaryotic cell.

if you look at mitochondria and chloroplasts they still have some of their own dna - the code their own proteins, self replicate and enter each new cell in cell division - they are not coded for by the nucleus.

for you to gain photosynthetic abilities you would need to form this symbiosis shomehow which isnt going to happen to mumans anytime soon as the opportunity isnt there.

through genetic manipulation we could, if we wanted, give ourselves chloroplasts but our body shaped to catch much sun anyway so we couldnt survive alone on it.

devance - im not sure i get what you are saying. some star wars creature? star wars isnt to scientifically accurate if you havent noticed.

evolution does still happen and will always happen.

as lonng as there is genetic variability and a selection process. i have a theory that if humans keep on driving for thousands of years we will all be better drivers. most car crashes involve young males before they have passed on their genes or often the offspring are in the car with the driver. this theory is a bit messed up by road rules.

if there were no road rules the gene pool would appraoach that better driver evolved state much quicker ;D

[Hagakure]

sorry i said in that last post that mitochondria and chlorplasts code for their own proteins not the nucleus but this isnt always the case.

genes from both are gradually moving into the nucleus for the benefits of having two copies as explained in my first post.

they are not conciously doing this "i will move into the nucleus so it is better for me" but in individuals where this has happened there are usually benefits that mean they are favoured by natural selection.

edited to correct some spelling

[ 28. May 2005, 07:31: Message edited by: Hagakure ]

[Prophet]

 

that is a disappointment. Maybe if some photosythetic bacteria invade one of my cells and we strike up some kind of symbiotic relationship which spreads too all my other cells in my body. I like the idea of photosynthesising to obtain food.

[Rev]

Its such a good idea its a curiousity it hasnt happenned much

must be some fundamental biochemical incompatabilities with higher animals

- coral and anemone do it so primitive animals seem ok with it

i like to think of evolution like a deck of cards

there are two mechanisms

shuffle - equals mutation in gene or gene placemnet in the genotype

and Cut - natural selection deletes any unfavourable cards in the phenotype

eventually u end up with the just the cards fitting the selction criteria

loser exit. winners go back to deck as breeders

shuffle and cut, shuffle and cut and nauseum on a grand scale.

so simple yet so damn effective

people dont understand evolution cos they dont understand how complex systems can have such simple rules.

[Ashoka]

Rev:

people dont understand evolution cos they dont understand how complex systems can have such simple rules.

A very nice quote! One I have to remember! Thanks to Hagakure for the basics on evolution.

[teonanacatl]

i always tell people that everything in life is so simple, and yet its so complex. they just think im silly lol. when i talk about psychedelic experiences i always find myself using contradictions, but its the only way to explain it in this world.

[reptyle]

What if physical evolution is the external manifestation of an internal and unconcious process of increasingly more complex categorisation(sp?) of creatable reality over an entity's many lifetimes?

and we have simply constructed a method of understanding individuals change in the physical plane?

i would posit that genes are the physical manifestations of the subtle energy within the self that can be redirected, manipulated and appears to evolve when perceived in the physical plane. genes are the building blocks of the physical ego, they are the simplest form of our attachment to a perciveable reality.

just a thought, i dont think this goes against the science. nor against the religion. but then again maybe it goes against both

would it be possible for a unit to evolve the biological protocols to direct the evolution of the next unit in the species?

[ 30. May 2005, 04:26: Message edited by: reptyle ]

[Legba]

i've seen how we are going to turn out. it was on a documetary on abc, sat. 1930hrs, called "Dr Who".

[ 30. May 2005, 06:01: Message edited by: Bacchant ]

[Nasojiti]

That's after 708 surgeries though.

[Hagakure]

well reptyle the whole system works fine with computer simulations and thats just using randomness and selection.

its tempting to think that animals might be able to influence future changes (i still have a bit of my brain im keeping open to it just in case) but in reality the whole process is so chaotic it would be far too hard to control.

i think resorting to thought of the spirtual plane etc in such topics doesnt give enough credit to how crazy this world is.

and i just remembered that there is a sea slug type creature that has mastered photosynthesis - the only animal i can think of that has achieved it. it is a lot like lichen. it goes through the water eating these photosynthetic bacteria which then take up residence in its body. the slug is see through so its pretty easy to guess the evolutionary pathway. see through slug eats photosynthetic bacteria, slugs with conditions most suiting the bacteria are most likely to survive eventually selecting for slugs which setup organic hotels for the little guys.

[Rev]

fuck yeah

if reincarnation exists im coming back as one of them

think about it

youre a slug - you taste awful so thing leave u alone

you just swim around sunbathing getting that sugar fix all day

when you can you eat what you can to feed your algae

and when you meet another slug you have wild sex cos you are both hermaphodites

[Auxin]

Hagakure:

it would indeed be great if we could photosynthesise but we have probably left the point from where we can do this.

Photosynthesis just makes sugar... as an american I gotta say over here we already have enough sugar in our diet, if we had chlorophyll the only difference would be the fat folks would be fatter and theyd lay naked in their front lawn while eating cheetoes and watching TV

I'll pass

[Hagakure]

sugar is a loaded term these days. it does indeed make glucose but after conversion to pyruvate this runs plant's mitochondria which produces most of the ATP required for the plant cells. when you eat bread you are just breaking to carbohydrates down into glucse for energy (simplified version)

if we just chucked chloroplasts into our cells there is still the issue of carbon dioxide for the reaction aswell. seeing that we dont have stomata in our skin it would be using the carbon dioxide released by the mtiochondria and making oxygen again. on a good day in the sun would this mean we would breathe less?

and yeah i agree that if we do get into the excess energy situation while plants grow we would get fat.

its a bit late down our evolutionary path to chuck it in now.

while we are discussing fantasy genetic manipulation here is an idea i had for a cyberpunk future. what if we could culture genetically modified bacteria in our gut that produce various drugs. only deal would be that to turn on these pathways you take a certain amount of enzyme that switches the process once then is degraded. you could therefore alter intensity with the amount of enzyme.

currently cant make enzymes illegal and in the fture it would be very hard to do aswell. drug labs would instead be protein factories and bacteria gm labs.

pay once off cost for bacteria (would be hard to monopolise this from a business point of view as so long as someone has the bacteria they can culture up more for others). then buy capsules of signal enzymes.

the problem would be if there was a mutation in the genes for bacteria that caused drug to be expressed without signal.

would probably be simpler to have vats of bacteria making your drugs now i think of it :D

[Qhorakuna tantani]

I know this is a little off topic but still with evolution... anyone heard the album LD50 by Mudvayne? They talk in a few of the tracks about (what I guess is their opinions), hallucinogens affecting the evolutionary path of animals. One quote from a track is "We are just an ape with a symbiotic relationship to a mushroom." I guess they focus soley on the link between ape and human as they talk about hallucinogens being the keys to doors in our brains and catalysts that sparked or somehow helped evolution. I guess i interperet it as hallucinogens expand(ed) consciousness to the point of evolution or possibly help the jump from primitive thinking to more advanced thinking ie language, culture, are a few things they talk about as well as religion, although I wouldn't specifically call that advanced thinking They also talk about this manipulation of neural transmitters and such as possibly opening untapped doorways to human potential. This is fairly breif in each song but very interesting ideas IMO. Just thought I'd add this... it's an interesting thought though and I thought fairly relevant.

If you can have a listen to the album ... the songs that just sound like wind chimes are the songs that have them talkin about all this. Also, the song pharmacopedia has a large list of drugs and plants that are "A few of their favorite things." They seem up to speed on their ethnobots :D . By the way... they are a heavy metal band if you didn't know. Just a warning .

[ 01. June 2005, 14:25: Message edited by: qhorakuna tantani ]

[Hagakure]

sounds like they are repeating some terrence mckenna ideas.

http://mckenna.psychedelic-library.org/

download "tree of knowledge" series

should explain it a bit deeper.

i like some of terrence but i havent had heroic doses of mushrooms nor have i tried DMT so i dont fully beleieve some of what he is saying sometimes :D

[Qhorakuna tantani]

This is a little contrary to what I've said but this is actually a song... the others are just noises and them talking.

Pharmacopia Lyrics

Have a look at these lyrics... like i said they seem to know what they're talkin about however, what is tetra-hydro-chloride? A google shows nothing about psychoactivity. Sorry to hijack the thread, resume the evolution talk.

[occidentalis]

Hagakure:

while we are discussing fantasy genetic manipulation here is an idea i had for a cyberpunk future. what if we could culture genetically modified bacteria in our gut that produce various drugs. only deal would be that to turn on these pathways you take a certain amount of enzyme that switches the process once then is degraded. you could therefore alter intensity with the amount of enzyme.

Read some Greg Egan. Particularly 'Luminous'. He discusses similar ideas in some detail.

One idea that he has is the have mobile, flexible neural cells implanted in the brain which respond to different chemicals by forming new neural pathways. Therefore certain senses or areas of sensory information can be enhanced by chewing on a certain chewing gum for instance.

[Tryptameanie]

 

quote:

---

what is tetra-hydro-chloride?

---

I'd guess it's misinformed/misremembered tetra-hydro-cannibinol, considering they've mispelt Halcium, dopeamine, Trisolam and zanex, and included non-psychoactives like histomine(also mispelt)and boric oxide.

Dunno about them "knowing what they're talking about".

[ 03. June 2005, 05:06: Message edited by: Tryptameanie ]