Jump to content
The Corroboree

eem

Members2
  • Content count

    28
  • Joined

  • Last visited

  • Days Won

    1

About eem

  • Rank
    Day Tripper

Profile Information

  • Country
    Australia

Previous Fields

  • Climate or location
    victoria

Recent Profile Visitors

725 profile views
  1. We have a series of online mycology lectures people might be interested in. They are all fundraisers for the Wild Fungi DNA project. Topics we have lined up so far include Cortinarius, Cordyceps and orchid mycorrhizae. More to be announced soon. https://myco.tidyhq.com/public/schedule/events http://myco.org.au/wild-dna-project/
  2. eem

    Edible/Medicinal culture seeking thread

    I am looking for Panellus stipticus (willing to pay cash or trade), but also trade for any species that I don't have. Also don't care if they are edible/medicinal so long as you know the species. Species I have: Lentinula edodes (shiitake) Coprinus comatus (lawyer’s wig) Hericium coralloides (relative of Lion’s mane) Ganoderma (reishi relative - species unknown, possible H. australe) Pleurotus ostreatus var columbrinus (blue oyster) Pleurotus djamor (pink oyster) Pleurotus ostreatus (tan oyster) Cordyceps gunnii (Australian native cordyceps) Flammunlina velutipes (enoki) Trametes versicolor (turkey tail) Polypore brumalis Agrocybe aegerite (pioppino) Pleurotus pulmonarius (phoenix oyster) Lentinula lateritia (Australian native shiitake) Pleurotus eryngii (king oyster) Oomphalotus nidiformis (ghost fungus)
  3. Would anyone be willing to sell or trade a Panellus culture?
  4. eem

    Microscopy and DNA workshops

    The workshop went really well. Very enthusiastic crowd. Everyone had a lot of fun. We'll probably keep doing them every few months. Great to hear you're starting a study group! It is really hard to learn without someone there showing you. I managed to work out how to do squash plates from a video, but couldn't work out what other sections were being taken until someone showed me IRL and then it was pretty easy. Might be worth making some videos or something. This book is worth checking out too. It has diagrams of microscopic features, measurements and chemical reactions https://shop.fungimap.org.au/product/larger-fungi-of-southern-australia/ And you're totally right re the optics.
  5. eem

    Edible Mushroom Book Recommendations

    This book has info about edibility, smell, taste (which doesn't necessarily mean it's edible - just put on tip of tongue then spit out) and known poisonous ones https://www.goodreads.com/book/show/6538650-common-australian-fungi
  6. eem

    Edible Mushroom Book Recommendations

    There isn't much known about the edibility of Australian mushrooms. Sometimes older books on mushrooms or bush foods discuss edibility, but new ones tend to avoid it incase it causes someone to poison themselves.
  7. For people in Vic there's a couple of workshops on fungal microscopy and DNA bar coding: Microscopy (June 22) https://bioquisitive.tidyhq.com/public/schedule/events/25136-fungi-microscopy?fbclid=IwAR2CbJvcLKAutGI7fPBRgl3uk_KieGA9BWN7NF4AMVbioLqccWirPD_6g70 Barcoding (May 28) https://bioquisitive.tidyhq.com/public/schedule/events/25122-dna-barcoding-fungi-yeast-plants
  8. eem

    Amanita muscaria ULTIMATE super-duper thread

    The strength of AM varies really widely with region. I have heard reports of inactive ones in the US. I've had ones I collected in Victoria that I prepared as food (sliced thinly, boiled for 5 min in lots of water, chucked water, repeat 4x) that left us feeling pretty stoned the next day. So I would be very careful translating dosage guides across different continents.
  9. eem

    Aus Mycology Study

    There's nowhere undergraduate in Australia. You have to do either a general biology degree or a botany degree and then specialise in honours and postgrad. Most of the basic biology, chemistry, ecology, genetics, etc. you do will be the same anyway. RMIT, Latrobe and Melbourne Uni (and probably other unis) all have some mycology stuff available post-grad. If you don't want the piece of paper you can study here https://mycologos.world But honestly I think getting a science degree is worth while if you really want to be good at what you do.
  10. Some more photos of the white gilled one with lactophenol cotton blue as the stain
  11. Below are photos of the white gilled one. There's definitely something weird going with the on with the cystidia but I am not sure exactly what. Also while the spore print was normal there were hardly any spores on the gill (unless those black things are actually attempts at spores).
  12. Below are photos of the freak gilled one. They look normal to me but I don't have much experience so if people could have a look that'd be great. Also stain is congo red and I think most photos taken at 1000x.
  13. Hi Spooge, I have a decent 100x light microscope and can take photos if you want to send me a print. PM me if you want. Also a friend of mine is checking out another different looking sub using alvalab after finding this thread. Will post results here.
  14. I transcribed the photos using the program below and pasted them in order of how they were posted by the OP (incase anyone else wants them). Though as MORG said they are prone to error. https://www.onlineocr.net I also checked, and there was both an ITS4 (the first 3 sequences below) and TEF (the last 2). >1. TTTTCTTGGTTCCTTTGAGGAAGTAAAAGT CGTAACAAGGTTTCCGTAGGTGAACCTGC GGAAGGATCATTATTGAATAACTTTGGCGT GGTT GTAGCTGGTCCTCTCGGGGGATGTGCTCG CCTGTCATCTTTATATCTCCACCTGTGCAC CTTTTGTAGACGTTGAAACTGGATAGGAG AGGG ACTTGTCCTTCAAGTTAAAGGTTTTTGCG CGCTCTACGTTTTCATATACCCCAAAGAAT GTAACAGAATGTATCTTATGGCTTTATGCC TATAA ACTATATACAACTTTCAGCAACGGATCTCT TGGCTCTCGCATCGATGAAGAACGCAGCG AAATGCGATAAGTAATGTGAATTGCAGAAT TCAGTG AATCATCGAATCTTTGAACGCACCTTGCG CTCCTTGGTATTCCGAGGAGCATGCCTGT TTGAGTGTCATTAAATTAAATTCTCAACCT TACCAGCTTTT GTTAGCTTGTGTAATGGCTTGGACTTGGG GGTCTTTTGCCGGCTTCTCTCGAGATGTC AGCTCCCCTTAAATGCATTAGCCGGCTGC CCGCT GTGGACCGTCTATTGGTGTGATAATTATCT ACGCCGTGGACGTCTGCTCTCAATGGGTT GAAGCTGCTTCTAACCGTCCGTTCATTCG GACA GCACATAATGACAATTGACCTCAAATCAGG TAGATTCC >2 TTAGAGGAAGTAAAAGTCGTAACAAGGTT TCCGTAGGTGAACCTGCGGAAGGATCATT ATTGAATAACTTTGGCGTGGTTGTAGCTG GTCCTCT CGGGGGCATGTGCTCGCCTGTCATCTTTA TATCTCCACCTGTGCACCTTTTGTAGACGT TGAAACTGGATAGGAGAGGGACTTGTCCT TCAAGT TAAAGGTTTTTCGGCGCTCTACGTTTTCAT ATACCCCAAAGAATGTAACAGAATGTATCT TATGGCTTTATGCCTATAAACTATATACAAC TTTC AGCAACGGATCTCTTGGCTCTCGCATCGA TGAAGAACGCAGCGAAATGCGATAAGTAA TGTGAATTGCAGAATTGCAGAATTCAGTGA ATCATCGAATCTTTG AACGCACCTTGCGCTCCTTGGTATTCCGA GGAGCATGCCTGTTTGAGTGTCATTAAATT CTCAACCTTACCAGCTTTTGTTAGCTTGTG TA ATG GCTTGGACTTGGGGGTCTTTTGCCGGCTT CTCTCGAGATGTCAGCTCCCCTTAAATGCA TTAGCCGGCTGCCCGCTGTGGACCGTCTA TTGG TGTGATAATTATCTACGCCGTGGACGTCTG CTCTCAATGGGTTGAAGCTGCTTCTAACC GTCCGTTCATTCGGACAGCAGATAATGAC AATTGA CCTCAAATCAGGTAGATTTCCC >3 TAGAGGAAGTAAAAGTCGTAACAAGGTTT CCGTAGGTGAACCTGCGGAAGGATCATTA TTGAATAACTTTGGCGTGGTTGTAGCTGG TCCTCT CGGGGGCATGTGCTCGCCCGTCATCTTTA TATCTCCACCTGTGCACCTTTTGTAGACGT TGAAACTGGATAGGAGAGGGACTTGTCCT TCAAGT TAAAGGTTTTTCGGCGCTCTACGTTTTCAT ATACCCCAAAGAATGTAACAGAATGTATCT TATGGCTTTATGCCTATAAACTATATACAAC TTTC AGCAACGGATCTCTTGGCTCTCGCATCGA TGAAGAACGCAGCGAAATGCGATAAGTAA TGTAATTGCAGAATTCAGTGAATCATCGAA TCTTTG AACGCACCTTGCGCTCCTTGGTATTCCGA GGAGCATGCCTGTTGAGTGTCATTAAATTC TCAACCTTACCAGCTTTTGTTAGCTTGTGT AATG GCTTGGACTTGGGGGTCTTTTGCCGGCTT CTCTCGAGATGTCAGCTCCCCTTAAATGCA TTAGCCGGCTGCCCGCTGTGGACCGTCTA C TTGG TGTGATAATTATCTACGCCGTGGACGTCTG CTCTCAATGGGTTGAAGCTGCTTCTAACC GTCCGTTCATTCGGACAGCAGATAATGAC AATTGA CTCCAAATCCAGGTAGGTT I attach the results of the TEF marker. Please tell me if you need anything else. kind regards 2017-752-ALV12600 1 --> ok, 99% Psilocybe cyanescens (GU565161), a few differences with P. weraroa (HF912344) 2017-752-ALV12601 2 --> double peaks, 205bp ok, corrected manually, 100% P. cyanescens (GU565161), 99% P. weraroa (HF912344) GTGCTATCCTTATCATCGCTGGAGGAACCGGTGAGTTTGAAGCTGGTATCTCCAAGGATG GCCAGACCCGCGAGCACGCTCTCCTCGCCTTCACCCTCGGTGTCCGTCAGCTCATCGTTG CCGTCAACAAGATGGACACCACCAAGGTAAATTTTTATTACGAAATCTTACTTTTTTAAA GACTCATAAAATTCTTTTTTTTTAAGTGGTCCGAAGATCGTTTCAACGAAATTATCAAGG AAACCTCCAACTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTTCCCA TTTCCGGATGGCACGGAGACAACATGTTGGAGGAGTCCACCAAGTATGCTGATTTCACTT TCCTTTGATCGTCTTAAATCTCATCTCTCTTCCTTTCTTCAGCATGCCCTGGTTCAAGGG TTGGTCTCGTGAGACCAAGGCCGGTGTYGTCAAGGGCAAGACCCTCCTCGATGCCATCGA TGCCATCGAGCCCCCCGTCCGTCCCTCCGACAAGCCCCTCCGTCTCCCCCTCCAGGATGT CTACAAGAT 2017-752-ALV12602 3 --> double peaks, 205bp ok, corrected manually, 100% P. cyanescens (GU565161), 99% P. weraroa (HF912344) GCTATCCTTATCATCGCTGGAGGAACCGGTGAGTTTGAAGCTGGTATCTCCAAGGATGGC CAGACCCGCGAGCACGCTCTCCTCGCCTTCACCCTCGGTGTCCGTCAGCTCATCGTTGCC GTCAACAAGATGGACACCACCAAGGTAAATTTTTATTACGAAATCTTACTTTTTTAAAGA CTCATAAAATTCTTTTTATTTAAGTGGTCCGAAGATCGTTTCAACGAAATTATCAAGGAA ACCTCCAACTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTTCCCATT TCCGGATGGCACGGAGACAACATGTTGGAGGAGTCCACCAAGTATGCTGATTTCACTTTC CTTTGATCGTCTTAAATCTCATCTCTCTICCITTCTTCAGCATGCCCTGGTTCAAGGGTT GGTCTCGTGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACCCTCCTCGATGCCATCGATG CCATCGAGCCCCCCGTCCGTCCCTCCGACAAGCCCCTCCGTCTCCCCCTCCAGGATGTCT ACAAGAT 3 attachments A10+12600 TEF-FEF198... 11 Rin_omni TEF-4-FF1PR
×