Jump to content
The Corroboree
spooge

subaeruginosa phenotypes that were DNA tested and the results

Recommended Posts

Good work Spooge. It's been interesting watching your work over various names. So cool.

  • Like 2

Share this post


Link to post
Share on other sites
1 hour ago, Slocombe said:

Good work Spooge. It's been interesting watching your work over various names. So cool.

Couldn't agree more....he's king of the subs!

  • Like 1

Share this post


Link to post
Share on other sites
On 11 April 2018 at 1:58 PM, MORG said:

The 99% similarity to P. cyanescens needs to be considered in the context of which locus you got sequenced, and there seems to be some confusion about that. The letter says TEF, while the chromatograms say ITS4. As mentioned, ITS is ideal for this, as it is the most widely used locus in molecular species delimitation. Species-level difference in ITS is typically 3 - 5% depending on the taxon. 

 

Can you upload or PM a text file of the sequences? This is the easiest way to work with the information. I'd be happy to help you make the most of this. 

 

 

Hello Morg, what pics are in the OP is all the info i have or was sent by alvalab. I will collect these samples again this season and have them tested again, i will list the tests that alvalab offer on this thread and hopefully people will let me know which tests to get done. Ive prints of both types if looking at them will help? Ive naturalised the 'freak gills' to my garden, they have fruited two years running, this year will hopefully be the year that the white gills also fruit.

 

Ive not the time to search and vet an australian place that will do the tests for me, if someone has or knows of a place in australia where these samples can be tested then please let me know, would need to be a commercial operation where i can pay for the service and not a backyard 'maybe we will get it done or not' etc freebie.....

 

On 6 April 2018 at 5:31 PM, botanika said:

I've often theorized aussie subs are actually Cyanscens due to forestry links between australia and west coast USA and the fact subs are almost always found in proximity to Pinus plantations and indigenous australians having no history of use. The variation between the species could be drift and local adaption over the relatively short period of logging in australia. 

 

Unless someone finds evidence to the contrary, I am not yet convinced subs are endemic to Australia.

 

I was a non beleiver also till i came to SA - where you can find a remnant peices of bush and in it are huge never logged  eucalypts and you find three of these huge trees together, around the base of one feeding on the celulose in the fallen bark are an indigenous cortinarius, around the base of the tree next to it is an indigenous mycenea and next to that indigenous subaeruginosa fruiting, not in droves like a pine patch but select larger fruits, the full seasons flush visable from old manky to fresh pins. Here like all states in aus there are areas where the introduced fungi have not made it yet, these are the areas that 'tell' me that subs are indeed an indigenous sp.

Edited by spooge
  • Like 2

Share this post


Link to post
Share on other sites
On 24/04/2018 at 9:19 AM, spooge said:

Hello Morg, what pics are in the OP is all the info i have or was sent by alvalab.

 

I should have been a bit clearer. Can you cut and paste the text of all the ATCGs in those screen shots? 

In order for anyone to use them they need to be in text format. Otherwise I'll have to transcribe from the .jpg screenshots into text, and this is tedious and prone to errors. 

If you paste the DNA sequence text in here, then I (or anyone else) can cut and paste to use for downstream analysis. 

  • Like 2

Share this post


Link to post
Share on other sites

I transcribed the photos using the program below and pasted them in order of how they were posted by the OP (incase anyone else wants them). Though as MORG said they are prone to error.
https://www.onlineocr.net

I also checked, and there was both an ITS4 (the first 3 sequences below) and TEF (the last 2). 

>1.

TTTTCTTGGTTCCTTTGAGGAAGTAAAAGT CGTAACAAGGTTTCCGTAGGTGAACCTGC GGAAGGATCATTATTGAATAACTTTGGCGT GGTT GTAGCTGGTCCTCTCGGGGGATGTGCTCG CCTGTCATCTTTATATCTCCACCTGTGCAC CTTTTGTAGACGTTGAAACTGGATAGGAG AGGG ACTTGTCCTTCAAGTTAAAGGTTTTTGCG CGCTCTACGTTTTCATATACCCCAAAGAAT GTAACAGAATGTATCTTATGGCTTTATGCC TATAA ACTATATACAACTTTCAGCAACGGATCTCT TGGCTCTCGCATCGATGAAGAACGCAGCG AAATGCGATAAGTAATGTGAATTGCAGAAT TCAGTG AATCATCGAATCTTTGAACGCACCTTGCG CTCCTTGGTATTCCGAGGAGCATGCCTGT TTGAGTGTCATTAAATTAAATTCTCAACCT TACCAGCTTTT GTTAGCTTGTGTAATGGCTTGGACTTGGG GGTCTTTTGCCGGCTTCTCTCGAGATGTC AGCTCCCCTTAAATGCATTAGCCGGCTGC CCGCT GTGGACCGTCTATTGGTGTGATAATTATCT ACGCCGTGGACGTCTGCTCTCAATGGGTT GAAGCTGCTTCTAACCGTCCGTTCATTCG GACA GCACATAATGACAATTGACCTCAAATCAGG TAGATTCC

 

>2
TTAGAGGAAGTAAAAGTCGTAACAAGGTT TCCGTAGGTGAACCTGCGGAAGGATCATT ATTGAATAACTTTGGCGTGGTTGTAGCTG GTCCTCT CGGGGGCATGTGCTCGCCTGTCATCTTTA TATCTCCACCTGTGCACCTTTTGTAGACGT TGAAACTGGATAGGAGAGGGACTTGTCCT TCAAGT TAAAGGTTTTTCGGCGCTCTACGTTTTCAT ATACCCCAAAGAATGTAACAGAATGTATCT TATGGCTTTATGCCTATAAACTATATACAAC TTTC AGCAACGGATCTCTTGGCTCTCGCATCGA TGAAGAACGCAGCGAAATGCGATAAGTAA TGTGAATTGCAGAATTGCAGAATTCAGTGA ATCATCGAATCTTTG AACGCACCTTGCGCTCCTTGGTATTCCGA GGAGCATGCCTGTTTGAGTGTCATTAAATT CTCAACCTTACCAGCTTTTGTTAGCTTGTG TA ATG GCTTGGACTTGGGGGTCTTTTGCCGGCTT CTCTCGAGATGTCAGCTCCCCTTAAATGCA TTAGCCGGCTGCCCGCTGTGGACCGTCTA TTGG TGTGATAATTATCTACGCCGTGGACGTCTG CTCTCAATGGGTTGAAGCTGCTTCTAACC GTCCGTTCATTCGGACAGCAGATAATGAC AATTGA CCTCAAATCAGGTAGATTTCCC

 

>3

TAGAGGAAGTAAAAGTCGTAACAAGGTTT CCGTAGGTGAACCTGCGGAAGGATCATTA TTGAATAACTTTGGCGTGGTTGTAGCTGG TCCTCT CGGGGGCATGTGCTCGCCCGTCATCTTTA TATCTCCACCTGTGCACCTTTTGTAGACGT TGAAACTGGATAGGAGAGGGACTTGTCCT TCAAGT TAAAGGTTTTTCGGCGCTCTACGTTTTCAT ATACCCCAAAGAATGTAACAGAATGTATCT TATGGCTTTATGCCTATAAACTATATACAAC TTTC AGCAACGGATCTCTTGGCTCTCGCATCGA TGAAGAACGCAGCGAAATGCGATAAGTAA TGTAATTGCAGAATTCAGTGAATCATCGAA TCTTTG AACGCACCTTGCGCTCCTTGGTATTCCGA GGAGCATGCCTGTTGAGTGTCATTAAATTC TCAACCTTACCAGCTTTTGTTAGCTTGTGT AATG GCTTGGACTTGGGGGTCTTTTGCCGGCTT CTCTCGAGATGTCAGCTCCCCTTAAATGCA TTAGCCGGCTGCCCGCTGTGGACCGTCTA

C TTGG TGTGATAATTATCTACGCCGTGGACGTCTG CTCTCAATGGGTTGAAGCTGCTTCTAACC GTCCGTTCATTCGGACAGCAGATAATGAC AATTGA CTCCAAATCCAGGTAGGTT

 

 

 

 

 

 

 

I attach the results of the TEF marker. Please tell me if you need

anything else.

kind regards

2017-752-ALV12600 1 --> ok, 99% Psilocybe cyanescens (GU565161), a few

differences with P. weraroa (HF912344)

2017-752-ALV12601 2 --> double peaks, 205bp ok, corrected manually,

100% P. cyanescens (GU565161), 99% P. weraroa (HF912344)

GTGCTATCCTTATCATCGCTGGAGGAACCGGTGAGTTTGAAGCTGGTATCTCCAAGGATG

GCCAGACCCGCGAGCACGCTCTCCTCGCCTTCACCCTCGGTGTCCGTCAGCTCATCGTTG

CCGTCAACAAGATGGACACCACCAAGGTAAATTTTTATTACGAAATCTTACTTTTTTAAA

GACTCATAAAATTCTTTTTTTTTAAGTGGTCCGAAGATCGTTTCAACGAAATTATCAAGG

AAACCTCCAACTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTTCCCA

TTTCCGGATGGCACGGAGACAACATGTTGGAGGAGTCCACCAAGTATGCTGATTTCACTT

TCCTTTGATCGTCTTAAATCTCATCTCTCTTCCTTTCTTCAGCATGCCCTGGTTCAAGGG

TTGGTCTCGTGAGACCAAGGCCGGTGTYGTCAAGGGCAAGACCCTCCTCGATGCCATCGA

TGCCATCGAGCCCCCCGTCCGTCCCTCCGACAAGCCCCTCCGTCTCCCCCTCCAGGATGT

CTACAAGAT

 

2017-752-ALV12602 3 --> double peaks, 205bp ok, corrected manually, 100% P. cyanescens (GU565161), 99% P. weraroa (HF912344) GCTATCCTTATCATCGCTGGAGGAACCGGTGAGTTTGAAGCTGGTATCTCCAAGGATGGC CAGACCCGCGAGCACGCTCTCCTCGCCTTCACCCTCGGTGTCCGTCAGCTCATCGTTGCC GTCAACAAGATGGACACCACCAAGGTAAATTTTTATTACGAAATCTTACTTTTTTAAAGA CTCATAAAATTCTTTTTATTTAAGTGGTCCGAAGATCGTTTCAACGAAATTATCAAGGAA ACCTCCAACTTCATCAAGAAGGTCGGTTACAACCCCAAGACCGTTGCCTTTGTTCCCATT TCCGGATGGCACGGAGACAACATGTTGGAGGAGTCCACCAAGTATGCTGATTTCACTTTC CTTTGATCGTCTTAAATCTCATCTCTCTICCITTCTTCAGCATGCCCTGGTTCAAGGGTT GGTCTCGTGAGACCAAGGCCGGTGTCGTCAAGGGCAAGACCCTCCTCGATGCCATCGATG CCATCGAGCCCCCCGTCCGTCCCTCCGACAAGCCCCTCCGTCTCCCCCTCCAGGATGTCT ACAAGAT

3 attachments

A10+12600 TEF-FEF198...

11 Rin_omni TEF-4-FF1PR

 

  • Like 3

Share this post


Link to post
Share on other sites

Thanks for doing that eem, that's great!.

 

i found the ones I typed out on a phone the other day......

 

image.png image.png

 

image.png image.png

 

image.png image.png

 

Soon they will be up again and I will get more samples.

 

i have prints if anyone has a nice microscope to see what the spores look like, be interesting to see if the spores of either of the samples match subaeruginosa.

 

 

 

  • Like 1

Share this post


Link to post
Share on other sites

I would disregard the comparison to Psilocybe cyanescens, and instead be thinking Psilocybe subaeruginosa.

 

Apparently Psilocybe cyanescens are insanely close genetically Psilocybe subaeruginosa, hence these being reported as the former.

 

I think if you really want to understand these differences in these specimens you need to did deeper and be thinking full genome sequencing.

 

at the moment we cannot be certain on phenotypic variations until we compare genes.  and there may even be structural mutations which are causing the split gills.

Share this post


Link to post
Share on other sites

Thanks Obtuse.

Maybe this summer i can sell enough plants to pay for full genome sequencing of subaeruginosa n then we will have results to asess finds like these against

 

Share this post


Link to post
Share on other sites

Hi Spooge, I have a decent 100x light microscope and can take photos if you want to send me a print. PM me if you want.

Also a friend of mine is checking out another different looking sub using alvalab after finding this thread. Will post results here.

 

On 6/6/2018 at 10:00 PM, spooge said:

 

 

i have prints if anyone has a nice microscope to see what the spores look like, be interesting to see if the spores of either of the samples match subaeruginosa.

 

 

 

  • Like 2

Share this post


Link to post
Share on other sites

Below are photos of the freak gilled one. They look normal to me but I don't have much experience so if people could have a look that'd be great. Also stain is congo red and I think most photos taken at 1000x.

 

 

 

 

Photo on 29-06-2018 at 2.31 PM.jpg

Photo on 29-06-2018 at 2.32 PM.jpg

Photo on 29-06-2018 at 2.36 PM.jpg

Photo on 29-06-2018 at 2.36 PM #2.jpg

Photo on 29-06-2018 at 2.37 PM.jpg

Photo on 29-06-2018 at 2.39 PM.jpg

Photo on 29-06-2018 at 2.40 PM.jpg

Photo on 29-06-2018 at 2.45 PM.jpg

Photo on 29-06-2018 at 2.55 PM.jpg

Photo on 29-06-2018 at 2.55 PM #2.jpg

Photo on 29-06-2018 at 2.58 PM.jpg

Photo on 29-06-2018 at 2.58 PM #2.jpg

Photo on 29-06-2018 at 3.00 PM.jpg

Photo on 29-06-2018 at 3.00 PM #2.jpg

Photo on 29-06-2018 at 3.01 PM.jpg

Photo on 29-06-2018 at 3.12 PM.jpg

Photo on 29-06-2018 at 3.22 PM.jpg

Photo on 29-06-2018 at 3.23 PM.jpg

  • Like 3

Share this post


Link to post
Share on other sites

Below are photos of the white gilled one. There's definitely something weird going with the on with the cystidia but I am not sure exactly what. Also while the spore print was normal there were hardly any spores on the gill (unless those black things are actually attempts at spores).

Photo on 29-06-2018 at 3.48 PM.jpg

Photo on 29-06-2018 at 3.49 PM.jpg

Photo on 29-06-2018 at 4.11 PM.jpg

Photo on 29-06-2018 at 4.11 PM #2.jpg

Photo on 29-06-2018 at 4.12 PM.jpg

Photo on 29-06-2018 at 4.12 PM #2.jpg

Photo on 29-06-2018 at 4.13 PM.jpg

Photo on 29-06-2018 at 4.19 PM.jpg

Photo on 29-06-2018 at 4.20 PM.jpg

Photo on 29-06-2018 at 4.21 PM.jpg

Photo on 29-06-2018 at 4.31 PM.jpg

Photo on 29-06-2018 at 4.32 PM.jpg

Photo on 29-06-2018 at 4.33 PM.jpg

Photo on 29-06-2018 at 4.34 PM.jpg

Photo on 29-06-2018 at 4.35 PM.jpg

Photo on 29-06-2018 at 4.35 PM #2.jpg

  • Like 5

Share this post


Link to post
Share on other sites

Thats really great Eem, THANK YOU so much for doing that.

 

 

  • Like 1

Share this post


Link to post
Share on other sites

This is awesome info, ive always wondered about this as I have seen a few around that i know are P. Sub but they do look and behave differently when fruiting for the most part. I kind of thought mayb its just the conditions changing their phenotypes but I wouldnt be surprised if they hybridised or diverged slightly in terms of genetics. There has been suggestion of sub species for some time now! Im always fascinated by the solitary growing glossy and dry yellow to gold capped ones in comparison to the dense colonies of more chocolate-tan coloured ones that tend to be shorter denser and a little slimy to the touch usually.

  • Like 1

Share this post


Link to post
Share on other sites

Some more photos of the white gilled one with lactophenol cotton blue as the stain

 

 

 

On 6/6/2018 at 10:00 PM, spooge said:

 

Photo on 5-07-2018 at 1.41 PM.jpg

Photo on 5-07-2018 at 1.44 PM.jpg

Photo on 5-07-2018 at 1.43 PM.jpg

Photo on 5-07-2018 at 1.40 PM #2.jpg

Photo on 5-07-2018 at 1.40 PM.jpg

Photo on 5-07-2018 at 1.39 PM.jpg

Share this post


Link to post
Share on other sites

Create an account or sign in to comment

You need to be a member in order to leave a comment

Create an account

Sign up for a new account in our community. It's easy!

Register a new account

Sign in

Already have an account? Sign in here.

Sign In Now

×